GBARROGA90GO GBARROGA90GO

Science

Answered

Pa sagot po..
Salamat
Hot or Heat po pag pipilian.
15 pts po.

Pa Sagot Po Salamat Hot Or Heat Po Pag Pipilian 15 Pts Po class=

Sagot :

HAMASAKIHANAKOGO HAMASAKIHANAKOGO

Answer:

1. Hot

2. Heat

3. Heat

4. Heat

5. Heat

Hope this helps ^^

Answer Link

Go Educations: Other Questions

2. What Did You Discover After Studying The Game CHESS?

Binabantayan Nito Ang Himpapawid Na Sakop Ng Pilipinas. Galit Ang Kanilang Radar Tinitayak Nito Ang Mga Sasakyang Panghimpapawid Na Pumapasok Sa Bansa.A. Hukbon

The Sequence Of DNA Is 5’ ATGCATAGATTAGGATATCCCAGATAG 3’. What Is The Sequence Of The Complimentary RNA Strand?(Pa Help Po Dito Please Pasahan Napo Kasi Mamaya)

Ginawa Ng Sanaysay Tungkol Sa Kabutihanpa Sagot Brainlist Q Den Heart Tenku

How Should An Instructor Act In Front Of His Recruits And Cadets? 

Pasagot Po Please Thanks

5. Opposite Sides Of Parallelogram And Rectangle Are ______?A. CongruentB. IntersectingC. Not EqualD. Linear Pair

E. Mark And Fred Were Close Friends. Being A Good Friend Mark Always Spent Time With Fred Whenever He Could. _______F. Evening Cames, Mother Cat Looking For B

Direction In A Brief Sentence, Answer The Question In Each Item. 1. What Particular Type Of Stressor You Often Encounter?2. How Do You Overcome Your Stress? 3.

1. In A Kite, The Perpendicular Bisector Of At Least One Diagonal Is The Other____. A. Diagonal B. Adjacent Side C. Congruent Side D. Angle2. The Area Of A Kite

Quarterly Payments Of P 5,000 For 10 Years P With An Interest Rate Of 2% Compounded Annually 20 . What The Future Velve What Are The Present Value Of (P)

Pagsagot Po Ng Maayos 